si:dkey-79l8.1

Ensembl ID:
ENSDARG00000061493
ZFIN IDs:
ZDB-GENE-080220-5, ZDB-GENE-090311-32
Description:
potassium voltage-gated channel subfamily G member 1 [Source:RefSeq peptide;Acc:NP_001103880]
Human Orthologue:
KCNG1
Human Description:
potassium voltage-gated channel, subfamily G, member 1 [Source:HGNC Symbol;Acc:6248]
Mouse Orthologue:
Kcng1
Mouse Description:
potassium voltage-gated channel, subfamily G, member 1 Gene [Source:MGI Symbol;Acc:MGI:3616086]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14567 Nonsense Available for shipment Available now
sa24395 Nonsense Available for shipment Available now
sa32465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101344 Nonsense 13 521 2 5
ENSDART00000141240   None 225 None 1
Genomic Location (Zv9):
Chromosome 23 (position 39432974)
Other Location(s):
Assembly Chromosome Position
GRCz11 23 39321632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGCTGAAAGATGACTTTACTGGCAGGCGATGGTTCGGATTATGACTA[C/A]AGCGCACTGAGCTGCACCTCTGACACCTCTCTRAACGCTCCACCCRTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101344 Nonsense 282 521 3 5
ENSDART00000141240   None 225 None 1
Genomic Location (Zv9):
Chromosome 23 (position 39476560)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39438261
GRCz11 23 39331172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCAGATGTGCTACAACATCTTCATCGTGGAGACGGTGTGCGTGGCCT[G/A]GTTCTCGCTGGAGTTCACTCTGCGCTTCATCCAGGATCGCAGCAAGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101344 Nonsense 420 521 4 5
ENSDART00000141240 Nonsense 124 225 1 1
Genomic Location (Zv9):
Chromosome 23 (position 39477110)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39438675
GRCz11 23 39331586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACGAAGCCGCAGCCACGAGGGAGTTCAGTAGCATCCCTGCCACATACT[G/A]GTGGGCTGTTATTACAATGACCACGGTTGGATATGGAGATATGGTGCCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link