si:dkeyp-86b9.1

Ensembl ID:
ENSDARG00000061486
ZFIN ID:
ZDB-GENE-060531-163
Description:
Novel protein similar to vertebrate dynein, cytoplasmic, heavy polypeptide 1 (DNCH1) [Source:UniProt
Human Orthologue:
DNAH10
Human Description:
dynein, axonemal, heavy chain 10 [Source:HGNC Symbol;Acc:2941]
Mouse Orthologue:
Dnahc10
Mouse Description:
dynein, axonemal, heavy chain 10 Gene [Source:MGI Symbol;Acc:MGI:1860299]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20435 Nonsense Available for shipment Available now
sa6980 Nonsense Mutation detected in F1 DNA During 2018
sa20436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087708 Nonsense 571 3330 10 58
ENSDART00000135878 Nonsense 1597 4262 24 70
Genomic Location (Zv9):
Chromosome 5 (position 29978050)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27733348
GRCz11 5 28333501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATGAAGGAGAGAAGCAGGCACTGAAGCAGTATGCAAAGAAAATGCAC[C/T]AGCAGATCAATGACCTGGTGAAACGCATCACAGAACCCTTAAAGAAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087708 Nonsense 1437 3330 26 58
ENSDART00000135878 Nonsense 2376 4262 38 70
Genomic Location (Zv9):
Chromosome 5 (position 29993908)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27749206
GRCz11 5 28349359
KASP Assay ID:
554-5010.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTGCAGCCATGGGGAAGGCAGGYGGTGGTAGGAATGAAGTGGACCCA[C/T]GATTCATMTCTCTTTTCAGTGTGTTCAACATCCCCTTCCCTGAGGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087708 Nonsense 3187 3330 56 58
ENSDART00000135878 Nonsense 4119 4262 68 70
Genomic Location (Zv9):
Chromosome 5 (position 30021643)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27776941
GRCz11 5 28377094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGTGCAGGTGAATGAAGGAGAGCCGTACGTGATGTGGCTCTCAGGTT[T/A]GCATATCCCTGAATCGTACCTGACTGCGTTGGTCCAGGCCACGTGCAGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiponectin levels: Novel loci for adiponectin levels and their influence on type 2 diabetes and metabolic traits: a multi-ethnic meta-analysis of 45,891 individuals. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link