
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000061481
- Ensembl ID:
- ENSDARG00000061481
- Human Orthologue:
- FRRS1
- Human Description:
- ferric-chelate reductase 1 [Source:HGNC Symbol;Acc:27622]
- Mouse Orthologue:
- Frrs1
- Mouse Description:
- ferric-chelate reductase 1 Gene [Source:MGI Symbol;Acc:MGI:108076]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30118 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11026 | Nonsense | Available for shipment | Available now |
sa19343 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa44166 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30118
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087724 | Nonsense | 85 | 570 | 2 | 15 |
- Genomic Location (Zv9):
- Chromosome 24 (position 30758927)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 29787742 GRCz11 24 29775893 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTAACGCTAAATAGCCAAACGGGATATTACTTTGAAGGCTTTATGTTG[C/T]AAGCACGCCCAGTTGGATCGAGCAGTACCATTGGCACTTTTTCTGTGACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11026
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087724 | Nonsense | 459 | 570 | 11 | 15 |
ENSDART00000087724 | Nonsense | 459 | 570 | 11 | 15 |
- Genomic Location (Zv9):
- Chromosome 24 (position 30745330)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 29774145 GRCz11 24 29762296 - KASP Assay ID:
- 554-6210.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTGTTTGGTGATGATCCTCAGTCTCATTCAGCCCATCGTCGCTGCTTTC[C/T]GATGTGAGCCGCAACATGAACGGTGAGAATATAACCANNGCTATGTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19343
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087724 | Nonsense | 459 | 570 | 11 | 15 |
ENSDART00000087724 | Nonsense | 459 | 570 | 11 | 15 |
- Genomic Location (Zv9):
- Chromosome 24 (position 30745330)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 29774145 GRCz11 24 29762296 - KASP Assay ID:
- 554-6210.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTGTTTGGTGATGATCCTCAGTCTCATTCAGCCCATCGTCGCTGCTTTC[C/T]GATGTGAGCCGCAACATGAACGGTGAGAATATAACCATAGCTATGTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44166
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087724 | Essential Splice Site | 486 | 570 | 12 | 15 |
- Genomic Location (Zv9):
- Chromosome 24 (position 30744967)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 29773782 GRCz11 24 29761933 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCAACTGGGCTCACTCCTGCAATGCTTTCGCCATCAAATGCCTGGCAGG[T/G]ATAGTATGATATCATTTCGTCAGTGTCTGCTCTGTTATTGTCCTCGGAAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- White matter integrity (interaction): White matter integrity as an intermediate phenotype: exploratory genome-wide association analysis in individuals at high risk of bipolar disorder. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: