si:dkey-253i9.4

Ensembl ID:
ENSDARG00000061459
ZFIN ID:
ZDB-GENE-090313-280
Human Orthologues:
RAPGEF2, RAPGEF6
Human Descriptions:
Rap guanine nucleotide exchange factor (GEF) 2 [Source:HGNC Symbol;Acc:16854]
Rap guanine nucleotide exchange factor (GEF) 6 [Source:HGNC Symbol;Acc:20655]
Mouse Orthologues:
Rapgef2, Rapgef6
Mouse Descriptions:
Rap guanine nucleotide exchange factor (GEF) 2 Gene [Source:MGI Symbol;Acc:MGI:2659071]
Rap guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI Symbol;Acc:MGI:2384761]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14351 Nonsense Available for shipment Available now
sa19478 Nonsense Available for shipment Available now
sa38258 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11830 Nonsense Available for shipment Available now
sa32653 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087670 Nonsense 53 1525 3 31
ENSDART00000141077 Nonsense 75 1463 4 28
ENSDART00000146630   None 1316 None 23

The following transcripts of ENSDARG00000061459 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 19954384)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20478801
GRCz11 1 21171738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGTGTNNNNNNNNTNNNNCTAGTCCTGATGACATCGGGACCTGCTGGTA[T/G]ATCCTTCTGTCTGGCTCGGTCTTCATAAAGGAGTCTATGTTTCTGCCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087670 Nonsense 432 1525 11 31
ENSDART00000141077 Nonsense 454 1463 12 28
ENSDART00000146630 Nonsense 307 1316 7 23

The following transcripts of ENSDARG00000061459 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 19942497)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20466914
GRCz11 1 21159851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCATTCAATCGTCGACCCCACATATATTGAGGACTTTCTCTTAACCTA[T/G]CGTACCTTCCTGCCCAGTCCTCTGATTCTGGGACAGAGACTTCTAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087670 Essential Splice Site 942 1525 18 31
ENSDART00000141077 Essential Splice Site 964 1463 19 28
ENSDART00000146630 Essential Splice Site 817 1316 14 23

The following transcripts of ENSDARG00000061459 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 19936204)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20460621
GRCz11 1 21153558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCACTGCCGCGACTGCAAGAACTTCAACTCTATGTTCGCCATTATCAG[G/A]TAGACTTTGTCTGTACATATACACTGTATACTAGAGATGTCCCGATCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087670 Nonsense 967 1525 19 31
ENSDART00000141077 Nonsense 989 1463 20 28
ENSDART00000146630 Nonsense 842 1316 15 23

The following transcripts of ENSDARG00000061459 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 19934560)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20458977
GRCz11 1 21151914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGTTGCGATCTACATGGGAACGGTTGCCTGGAAAATACGAGAAGCTTT[T/A]GGCTGAATTACAGGATGTTTTWGACCCTTCTCGCAACATGGCCAAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087670 Nonsense 1108 1525 22 31
ENSDART00000141077 Nonsense 1130 1463 23 28
ENSDART00000146630 Nonsense 983 1316 18 23

The following transcripts of ENSDARG00000061459 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 19931277)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20455694
GRCz11 1 21148631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAAGAAACTGTATGAGGTGGAGATGATGAGCAGACGTGTGCGCCAGTA[T/A]CTGGACACGCACTCAAACGAGTGCAACGAGGACACACTTCATGAGCTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link