si:dkeyp-89d7.1

Ensembl ID:
ENSDARG00000061458
ZFIN ID:
ZDB-GENE-030131-1796
Description:
PHD finger protein 14 [Source:RefSeq peptide;Acc:NP_001038252]
Human Orthologue:
PHF14
Human Description:
PHD finger protein 14 [Source:HGNC Symbol;Acc:22203]
Mouse Orthologue:
Phf14
Mouse Description:
PHD finger protein 14 Gene [Source:MGI Symbol;Acc:MGI:1923539]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23576 Nonsense Available for shipment Available now
sa5650 Splice Site, Nonsense F2 line generated During 2018
sa3007 Splice Site, Nonsense F2 line generated During 2018
sa43328 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087662 Nonsense 563 900 9 18
ENSDART00000103114   None 507 None 12
Genomic Location (Zv9):
Chromosome 19 (position 39765289)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38629272
GRCz11 19 38216392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGGACACATCTGATATCAGTGCAAGCGTGGATGGACGACGCAAACAT[A/T]AGCAGCCTGCTCTCACTGCAGACTTTGTGAACTACTACCTTGGTATGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5650
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087662 Splice Site, Nonsense 725 900 14 18
ENSDART00000103114 Splice Site, Nonsense 332 507 8 12
ENSDART00000087662 Splice Site, Nonsense 725 900 14 18
ENSDART00000103114 Splice Site, Nonsense 332 507 8 12
Genomic Location (Zv9):
Chromosome 19 (position 39793675)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38657658
GRCz11 19 38244778
KASP Assay ID:
554-2631.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAGCAAAAGAGAATACCTGACTCTTTCATCGCTCATCTTTTCCAGG[C/T]AGTGCTCTGAGTGCGACCAGGCCAGCAGTGAYGAGGCTGACATCGCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3007
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087662 Splice Site, Nonsense 725 900 14 18
ENSDART00000103114 Splice Site, Nonsense 332 507 8 12
ENSDART00000087662 Splice Site, Nonsense 725 900 14 18
ENSDART00000103114 Splice Site, Nonsense 332 507 8 12
Genomic Location (Zv9):
Chromosome 19 (position 39793675)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38657658
GRCz11 19 38244778
KASP Assay ID:
554-2631.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAGCAAAAGAGAATACCTGACTCTTTCATCGCTCATCTTTTCCAGG[C/T]AGTGCTCTGAGTGCGACCAGGCCAGCAGTGAYGAGGCTGACATCGCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087662 Nonsense 858 900 17 18
ENSDART00000103114 Nonsense 465 507 11 12
Genomic Location (Zv9):
Chromosome 19 (position 39842124)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38706107
GRCz11 19 38293227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCGGCTCTGCTACCACTTCGGCTGTCTGGACCCTCCCCTGAAGAAGT[C/A]GCCCAAACAAACAGGTTATGGATGGATCTGTCAGGAATGTGACACCTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link