zgc:158349

Ensembl ID:
ENSDARG00000061450
ZFIN ID:
ZDB-GENE-070209-68
Description:
dual specificity testis-specific protein kinase 2 [Source:RefSeq peptide;Acc:NP_001103946]
Human Orthologue:
TESK2
Human Description:
testis-specific kinase 2 [Source:HGNC Symbol;Acc:11732]
Mouse Orthologue:
Tesk2
Mouse Description:
testis-specific kinase 2 Gene [Source:MGI Symbol;Acc:MGI:2385204]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16291 Essential Splice Site Available for shipment Available now
sa16358 Essential Splice Site Available for shipment Available now
sa2050 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa16291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087643 Essential Splice Site 115 634 4 11
ENSDART00000122856 Essential Splice Site 115 634 3 10
Genomic Location (Zv9):
Chromosome 2 (position 27502555)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27698751
GRCz11 2 27354385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTTCAGAGCATTAAACTYGCWTTTCTGTGTGTRTTTTTGTGATGTA[G/T]ATTCATGGGGGTGTGTGTACAGGAAGGTCAGCTCCATGCGCTCACAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087643 Essential Splice Site 236 634 7 11
ENSDART00000122856 Essential Splice Site 236 634 6 10
Genomic Location (Zv9):
Chromosome 2 (position 27518222)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27714418
GRCz11 2 27370052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGYTCTGGATGGCTCCAGAAGTGTTGAGAGACGAACCGTACAACGAAAAG[G/A]TTCCATTCTTGGCTTCATTCANNAATWGGCACTATCACAAACCTTGTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2050
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087643 Nonsense 247 634 8 11
ENSDART00000122856 Nonsense 247 634 7 10
Genomic Location (Zv9):
Chromosome 2 (position 27518356)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27714552
GRCz11 2 27370186
KASP Assay ID:
554-3006.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCATTCATTTTTTAGGCTGATGTCTTTTCGTATGGCATTATTCTGTG[C/A]GAAATCATTGCAAGGATACAGGCTGACCCAGACTACCTGCCACGCACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link