adcy6a

Ensembl ID:
ENSDARG00000061445
ZFIN ID:
ZDB-GENE-060221-1
Human Orthologue:
ADCY6
Human Description:
adenylate cyclase 6 [Source:HGNC Symbol;Acc:237]
Mouse Orthologue:
Adcy6
Mouse Description:
adenylate cyclase 6 Gene [Source:MGI Symbol;Acc:MGI:87917]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37642 Essential Splice Site Mutation detected in F1 DNA During 2018
sa29893 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43925 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087654 Essential Splice Site 365 1203 3 23
Genomic Location (Zv9):
Chromosome 23 (position 14117949)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14249882
GRCz11 23 14005959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATACATCCAGGCCCGACTGCACCTGCAGAGAGAAAACCAGCAGCAGG[T/C]CAGTACAGGATGACAAGTCCCTTCTTAACCCCCAGGGGTCGAAGACCGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087654 Essential Splice Site 1120 1203 21 23
Genomic Location (Zv9):
Chromosome 23 (position 14058080)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14190013
GRCz11 23 13946090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAATACATCAATGAGCATTCCTTCAACAACTTCCAGATGAAGATCGG[T/C]GAGTCCACTAATTATCGCCTTCCAGCGAATTTAAAAAGATTTGGTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087654 Nonsense 1141 1203 22 23
Genomic Location (Zv9):
Chromosome 23 (position 14056331)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14188264
GRCz11 23 13944341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGTGGTCGCAGGTGTTATTGGAGCCAGGAAGCCCCAGTATGATATTT[G/A]GGGAAACACAGTAAACGTGGCCAGTCGGATGGACAGTACGGGAGTCCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link