slx4

Ensembl ID:
ENSDARG00000061414
ZFIN ID:
ZDB-GENE-050208-359
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MT56]
Human Orthologue:
SLX4
Human Description:
SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:23845]
Mouse Orthologue:
Btbd12
Mouse Description:
BTB (POZ) domain containing 12 Gene [Source:MGI Symbol;Acc:MGI:106299]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45773 Nonsense Mutation detected in F1 DNA During 2018
sa18364 Nonsense Available for shipment Available now
sa24191 Essential Splice Site Available for shipment Available now
sa29809 Nonsense Mutation detected in F1 DNA During 2018
sa37533 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087576 Nonsense 307 1719 4 13
ENSDART00000105002   None 116 None 2
ENSDART00000147719   None 208 None 3
Genomic Location (Zv9):
Chromosome 22 (position 27428356)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26943801
GRCz11 22 26806253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGCTGGCTCTGTCCCGCTCTCTGCTGGAGCAGGAGGTGGAGAAAAAG[C/T]GAGAGCTGGAGGAGCAGAGGGAAATTCTGGCTCAGATCTCCAGCCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087576 Nonsense 411 1719 5 13
ENSDART00000105002   None 116 None 2
ENSDART00000147719   None 208 None 3
Genomic Location (Zv9):
Chromosome 22 (position 27429230)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26944675
GRCz11 22 26807127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTCTTCAACCTCACGCACCCCTCTGGGACAAAAGCGCTCTTCACAGAGGA[C/T]GACAAAACTCTGTTTCAGAGTTCTACACGTCTGAGTTGAGCAGCTTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087576 Essential Splice Site 643 1719 10 13
ENSDART00000105002   None 116 None 2
ENSDART00000147719   None 208 None 3
Genomic Location (Zv9):
Chromosome 22 (position 27433945)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26949390
GRCz11 22 26811842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCTGTGTATAAAATGAGATTGCAGTAGCAAATCTTGTGATAATTTTC[A/G]GGTTTGGTTTAGCTGAGCTACAGCAGCAGTGTGAGGAGTATTCTGGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087576 Nonsense 754 1719 10 13
ENSDART00000105002   None 116 None 2
ENSDART00000147719   None 208 None 3
Genomic Location (Zv9):
Chromosome 22 (position 27434279)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26949724
GRCz11 22 26812176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGAGATCTATGAGTTTGCAGCGACACAAAGAAAGACGGAGACAATGT[T/A]GGAAACTGCGACAGAGACTGAGGACGATGAGGGAGATGCAAATACATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087576 Nonsense 1075 1719 10 13
ENSDART00000105002   None 116 None 2
ENSDART00000147719   None 208 None 3
Genomic Location (Zv9):
Chromosome 22 (position 27435243)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26950688
GRCz11 22 26813140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAAGTTTCCTGGCTGATTCCAGCTACTCCGGTACCATCCACACGATG[T/A]AGCTCTGCCCAGACATGCGTCACTATGCGCCGAACTCAGCTATTCCCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link