zgc:153298

Ensembl ID:
ENSDARG00000061405
ZFIN ID:
ZDB-GENE-060929-200
Description:
Protein FAM176A [Source:UniProtKB/Swiss-Prot;Acc:Q08CB3]
Human Orthologue:
FAM176A
Human Description:
family with sequence similarity 176, member A [Source:HGNC Symbol;Acc:25816]
Mouse Orthologue:
Fam176a
Mouse Description:
family with sequence similarity 176, member A Gene [Source:MGI Symbol;Acc:MGI:2385247]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28886 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087565 Nonsense 152 153 4 4
Genomic Location (Zv9):
Chromosome 17 (position 32812056)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32653787
GRCz11 17 32606298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATGAACGGACAGCCGGACATGCCGGGCACGCGCAGCCTCAACCGCTA[T/G]TATTAAAAAAAGACTGAAGTTTGGAGAATACGTTTGAAAATGTATTAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link