zgc:162329

Ensembl ID:
ENSDARG00000061399
ZFIN ID:
ZDB-GENE-070424-31
Description:
hypothetical protein LOC569946 [Source:RefSeq peptide;Acc:NP_001103949]
Human Orthologue:
TRPM1
Human Description:
transient receptor potential cation channel, subfamily M, member 1 [Source:HGNC Symbol;Acc:7146]
Mouse Orthologue:
Trpm1
Mouse Description:
transient receptor potential cation channel, subfamily M, member 1 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38126 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa38127 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24717 Essential Splice Site Available for shipment Available now
sa24718 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24719 Nonsense Available for shipment Available now
sa15364 Nonsense Available for shipment Available now
sa9727 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087497 Missense 4 297 4 8
ENSDART00000123249 Essential Splice Site 92 1290 None 28
Genomic Location (Zv9):
Chromosome 25 (position 35402229)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34145494
GRCz11 25 34586116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAGTATATCC[G/A]GGTGTCTCATGACACTAAGCCGGACAGTTTGCTGCATCTGATGGTGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087497 Essential Splice Site 171 297 6 8
ENSDART00000123249 Essential Splice Site 258 1290 5 28
Genomic Location (Zv9):
Chromosome 25 (position 35406039)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34149304
GRCz11 25 34589926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACGCAGGCAGCTGGAGAAGCACATCTCGCTCCAGAAGATTAACACTC[G/A]TAAGTGCGGCGGCATCAGAGAATCTTATCTGCTTTAGGTCTAATGTACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087497 Essential Splice Site 172 297 6 8
ENSDART00000123249 Essential Splice Site 259 1290 5 28
Genomic Location (Zv9):
Chromosome 25 (position 35406040)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34149305
GRCz11 25 34589927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACGCAGGCAGCTGGAGAAGCACATCTCGCTCCAGAAGATTAACACTCG[T/C]AAGTGCGGCGGCATCAGAGAATCTTATCTGCTTTAGGTCTAATGTACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087497   None 297 None 8
ENSDART00000123249 Essential Splice Site 520 1290 12 28
Genomic Location (Zv9):
Chromosome 25 (position 35421911)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34165176
GRCz11 25 34605798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGATTAGAGGAGTTATACAACACTGTAAGCACCACAACCATTATCATTC[T/C]GGAGCTTAACTCAAAGGAAGTACAACACAGCATCAGAGCAAGTCACTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087497   None 297 None 8
ENSDART00000123249 Nonsense 788 1290 19 28
Genomic Location (Zv9):
Chromosome 25 (position 35426626)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34169891
GRCz11 25 34610513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGACACGTCTCATCAGGTTGCTGTGGCCGATGAAGACAAAAAGACC[A/T]AAGATGATGAAAGATCCACTCGGGTAAAGTGGACGACTCTTCTTTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087497   None 297 None 8
ENSDART00000123249 Nonsense 1095 1290 26 28
ENSDART00000087497   None 297 None 8
ENSDART00000123249 Nonsense 1095 1290 26 28
Genomic Location (Zv9):
Chromosome 25 (position 35429697)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34172962
GRCz11 25 34613584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAAAGCAACACATTCTTTGAGGTTAAGTCCATCTCCAACCAGGTKTGG[A/T]AGTTCCAGAGATATCAGCTCATCATGACCYTTCACGACAGACCTGTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087497   None 297 None 8
ENSDART00000123249 Nonsense 1095 1290 26 28
ENSDART00000087497   None 297 None 8
ENSDART00000123249 Nonsense 1095 1290 26 28
Genomic Location (Zv9):
Chromosome 25 (position 35429697)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34172962
GRCz11 25 34613584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAAAGCAACACATTCTTTGAGGTTAAGTCCATCTCCAACCAGGTKTGG[A/T]AGTTCCAGAGATATCAGCTCATCATGACCTTTCACGACAGACCTGTGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link