znf142

Ensembl ID:
ENSDARG00000061373
ZFIN ID:
ZDB-GENE-080512-2
Human Orthologue:
ZNF142
Human Description:
zinc finger protein 142 [Source:HGNC Symbol;Acc:12927]
Mouse Orthologue:
Zfp142
Mouse Description:
zinc finger protein 142 Gene [Source:MGI Symbol;Acc:MGI:1924514]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7202 Nonsense Mutation detected in F1 DNA During 2018
sa17185 Nonsense Available for shipment Available now
sa21545 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087409 Nonsense 71 1408 1 7
ENSDART00000148268 Nonsense 141 1535 4 8
Genomic Location (Zv9):
Chromosome 9 (position 39449194)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38587090
GRCz11 9 38396885
KASP Assay ID:
554-5432.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCAAGCTACGTGTCCACATGCTGAGAGAGATGGGACAGAMGCTGCAC[C/T]AGTGTCATCTATGCGAGTATAAAGCAGTGGAACGCAATTCTTTACGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087409 Nonsense 796 1408 4 7
ENSDART00000148268 Nonsense 874 1535 6 8
Genomic Location (Zv9):
Chromosome 9 (position 39444544)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38582440
GRCz11 9 38392235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATGTAATAGATGAGACTGACTCGCTGCCAAGCACTTCTGAAGAAGGG[C/T]AGGCAACTATCAGGACTATAAACAARTTAGCGAAARTGGATGTATCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087409 Nonsense 873 1408 5 7
ENSDART00000148268 Nonsense 965 1535 6 8
Genomic Location (Zv9):
Chromosome 9 (position 39444271)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38582167
GRCz11 9 38391962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATGACTCAGACCAGGAAGATGAGGATGTAGATGGGGCAAATGACTCT[G/T]AAGGGGATTCGGCAGTAGACGAGAGATCGCCAAGCTCCATACCCCGATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link