adat1

Ensembl ID:
ENSDARG00000061348
ZFIN ID:
ZDB-GENE-070410-64
Description:
tRNA-specific adenosine deaminase 1 [Source:RefSeq peptide;Acc:NP_001076356]
Human Orthologue:
ADAT1
Human Description:
adenosine deaminase, tRNA-specific 1 [Source:HGNC Symbol;Acc:228]
Mouse Orthologue:
Adat1
Mouse Description:
adenosine deaminase, tRNA-specific 1 Gene [Source:MGI Symbol;Acc:MGI:1353631]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38130 Nonsense Available for shipment Available now
sa39491 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087410 Nonsense 319 466 6 9

The following transcripts of ENSDARG00000061348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 35885186)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34316518
GRCz11 25 34821476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTAATAAAACATTTTTCCTCTCTTGTAGTTGTTCCCATGTGAAGGATT[T/A]GCCGTCTGGTTTCTCCTTCCATGATCCGGAGCTTCTTCAGTCCAGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087410 Nonsense 414 466 8 9

The following transcripts of ENSDARG00000061348 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 35889678)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34321010
GRCz11 25 34825968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTAAGGTGGAGCTCTTTCATTCGTTTCTGAAAGTGGTGGCGGCCACT[G/T]AAGACGCTGAGCTTCCAGAAACCCTCCGGTGAGTGGAATAGCTAACATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link