wwp2

Ensembl ID:
ENSDARG00000061345
ZFIN ID:
ZDB-GENE-000607-82
Description:
NEDD4-like E3 ubiquitin-protein ligase WWP2 [Source:RefSeq peptide;Acc:NP_001092918]
Human Orthologue:
WWP2
Human Description:
WW domain containing E3 ubiquitin protein ligase 2 [Source:HGNC Symbol;Acc:16804]
Mouse Orthologue:
Wwp2
Mouse Description:
WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44346 Nonsense Mutation detected in F1 DNA During 2018
sa19371 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087364 Nonsense 627 866 17 23
ENSDART00000136640 Nonsense 627 866 19 25
ENSDART00000139582   None 46 None 4
ENSDART00000141473   None 276 None 8

The following transcripts of ENSDARG00000061345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 35860687)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34292019
GRCz11 25 34796977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTTGTATCATGGGAAGTTCATTGACACAGGCTTCACTTTGCCATTCTA[C/A]AAGCGGATGCTGAACAAGAAGCCCACGCTGAAAGACCTGGAGTCCATCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087364 Essential Splice Site 834 866 22 23
ENSDART00000136640 Essential Splice Site 834 866 24 25
ENSDART00000139582   None 46 None 4
ENSDART00000141473   None 276 None 8

The following transcripts of ENSDARG00000061345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 35865140)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34296472
GRCz11 25 34801430
KASP Assay ID:
2261-7175.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATAGACAAAGTGGGGAAGGAAACATGGCTGCCTAGAAGTCACACTTGG[T/G]GAGGCTCAAAAAAACAAAAAACAACAACAACTATTAAAACATGCCTTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgE levels : A meta-analysis of genome-wide association studies for serum total IgE in diverse study populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link