
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:136869
- Ensembl ID:
- ENSDARG00000061301
- ZFIN ID:
- ZDB-GENE-060421-6836
- Description:
- zgc:136869 [Source:RefSeq peptide;Acc:NP_001035394]
- Human Orthologue:
- GMPR2
- Human Description:
- guanosine monophosphate reductase 2 [Source:HGNC Symbol;Acc:4377]
- Mouse Orthologue:
- Gmpr2
- Mouse Description:
- guanosine monophosphate reductase 2 Gene [Source:MGI Symbol;Acc:MGI:1917903]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7062 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa902 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa7062
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087298 | Nonsense | 80 | 348 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 7 (position 25369184)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 23930936 GRCz11 7 24202093 - KASP Assay ID:
- 554-5203.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACATTATTTTTTTGTAGTTTAGCCTCTTTACAGCCATGCAAAAGCATTA[C/A]GGTGTTGACGACTGGAAGGARTTTGCAGCCAAGCACCCAGAATGCTTAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa902
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087298 | Nonsense | 327 | 348 | 9 | 9 |
- Genomic Location (Zv9):
- Chromosome 7 (position 25365604)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 23927356 GRCz11 7 24198513 - KASP Assay ID:
- 554-0809.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGAGTTCGCTCCACCTGCACTTATGTGGGCGCTGCTAAGCTGAAAGAGT[T/A]GAGCCGTCGTACCACCTTCATTAGGGTGACCCAGCAGCTCAACACAGTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: