zgc:136869

Ensembl ID:
ENSDARG00000061301
ZFIN ID:
ZDB-GENE-060421-6836
Description:
zgc:136869 [Source:RefSeq peptide;Acc:NP_001035394]
Human Orthologue:
GMPR2
Human Description:
guanosine monophosphate reductase 2 [Source:HGNC Symbol;Acc:4377]
Mouse Orthologue:
Gmpr2
Mouse Description:
guanosine monophosphate reductase 2 Gene [Source:MGI Symbol;Acc:MGI:1917903]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7062 Nonsense Mutation detected in F1 DNA During 2018
sa902 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087298 Nonsense 80 348 3 9
Genomic Location (Zv9):
Chromosome 7 (position 25369184)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23930936
GRCz11 7 24202093
KASP Assay ID:
554-5203.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATTATTTTTTTGTAGTTTAGCCTCTTTACAGCCATGCAAAAGCATTA[C/A]GGTGTTGACGACTGGAAGGARTTTGCAGCCAAGCACCCAGAATGCTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087298 Nonsense 327 348 9 9
Genomic Location (Zv9):
Chromosome 7 (position 25365604)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23927356
GRCz11 7 24198513
KASP Assay ID:
554-0809.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGTTCGCTCCACCTGCACTTATGTGGGCGCTGCTAAGCTGAAAGAGT[T/A]GAGCCGTCGTACCACCTTCATTAGGGTGACCCAGCAGCTCAACACAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link