lss

Ensembl ID:
ENSDARG00000061274
ZFIN ID:
ZDB-GENE-050119-7
Description:
lanosterol synthase [Source:RefSeq peptide;Acc:NP_001077036]
Human Orthologue:
LSS
Human Description:
lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) [Source:HGNC Symbol;Acc:6708]
Mouse Orthologue:
Lss
Mouse Description:
lanosterol synthase Gene [Source:MGI Symbol;Acc:MGI:1336155]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34708 Nonsense Mutation detected in F1 DNA During 2018
sa7203 Nonsense Mutation detected in F1 DNA During 2018
sa41487 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8442 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8616 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34709 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087241 Nonsense 235 735 7 22
Genomic Location (Zv9):
Chromosome 9 (position 39538414)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38676310
GRCz11 9 38486105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCCCTCCTGGATGCCAGCACACCCCTCCACATTATGGTGCCACTGT[C/T]GACAGGTCTACCTGCCCATGAGCTACTGCTACGCAGTCAGGCTCTCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087241 Nonsense 284 735 8 22
Genomic Location (Zv9):
Chromosome 9 (position 39540745)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38678641
GRCz11 9 38488436
KASP Assay ID:
554-5331.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTACTCCACTATTGACTGGCCAGCTCAGAGGAACAACGTTGCARCCTG[T/A]GATTTATACACACCRCACAGCAACTTGCTTACTTTCGCTTATTGTGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087241 Essential Splice Site 490 735 15 22
Genomic Location (Zv9):
Chromosome 9 (position 39543450)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38681346
GRCz11 9 38491141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCAAAGAGAACATTCCCAAGGAAAGGCTTTTTGATGCTGTCAATGTG[G/A]TAATAACCTTACTTGTGTATATACTGTCTGTTTTGAATGCTGACATAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087241 Essential Splice Site 490 735 15 22
ENSDART00000087241 Essential Splice Site 490 735 15 22
Genomic Location (Zv9):
Chromosome 9 (position 39543451)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38681347
GRCz11 9 38491142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTSAAAGAGAACATTCCCAAGGAAAGGCTTTTTGATGCTGTCAATGTGG[T/A]AATAACCTTACTTGTGTATATACTGTCTGTTTYGAATGCTGAMATAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087241 Essential Splice Site 490 735 15 22
ENSDART00000087241 Essential Splice Site 490 735 15 22
Genomic Location (Zv9):
Chromosome 9 (position 39543451)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38681347
GRCz11 9 38491142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTSAAAGAGAACATTCCCAAGGAAAGGCTTTTTGATGCTGTCAATGTGG[T/A]AATAACCTTACTTGTGTATATACTGTCTGTTTYGAATGCTGAMATAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087241 Nonsense 531 735 17 22
Genomic Location (Zv9):
Chromosome 9 (position 39547013)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38684909
GRCz11 9 38494704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCCTGTTAAATGTCTCTTTCAGGTGATATAATGATTGACTACACGTA[T/A]GTTGAGTGCACCTCAGCTGTACTGCAGGCATTGAAACATTTTCACAGCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link