si:dkey-44g23.5

Ensembl ID:
ENSDARG00000061256
ZFIN ID:
ZDB-GENE-041008-233
Description:
hypothetical protein LOC567109 [Source:RefSeq peptide;Acc:NP_001038592]
Human Orthologue:
FAM195A
Human Description:
family with sequence similarity 195, member A [Source:HGNC Symbol;Acc:14142]
Mouse Orthologue:
Fam195a
Mouse Description:
family with sequence similarity 195, member A Gene [Source:MGI Symbol;Acc:MGI:1915491]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24192 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087202 Nonsense 130 143 5 5
Genomic Location (Zv9):
Chromosome 22 (position 27444786)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26960231
GRCz11 22 26822683
KASP Assay ID:
2261-6958.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATCTCTTGTATTTCCCTTAGATTTTGTGCCGATTGATCTCGAGGAGT[G/A]GTGGGCGCAGCGTTTCCTGGCTAACATTGCCAACCTGTCATGACAGGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link