myom1a

Ensembl ID:
ENSDARG00000061249
ZFIN ID:
ZDB-GENE-030131-2856
Description:
myomesin 1a [Source:RefSeq peptide;Acc:NP_001154812]
Human Orthologue:
MYOM1
Human Description:
myomesin 1, 185kDa [Source:HGNC Symbol;Acc:7613]
Mouse Orthologue:
Myom1
Mouse Description:
myomesin 1 Gene [Source:MGI Symbol;Acc:MGI:1341430]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38338 Nonsense Mutation detected in F1 DNA During 2018
sa25832 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25833 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32946 Nonsense Mutation detected in F1 DNA During 2018
sa39849 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087126 Nonsense 214 1483 5 37
ENSDART00000131606   None 323 None 10
ENSDART00000137012 Nonsense 208 1453 5 36

The following transcripts of ENSDARG00000061249 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30638421)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30940056
GRCz11 2 30923589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTGCAGGTACAAAAACAATGTTCTAATCGATGCCAAGGCTCGCCCT[G/T]AGAAATACTTCACAGAGAGCCAATACAACATGCACTCTTTGGAAATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087126 Essential Splice Site 675 1483 15 37
ENSDART00000131606   None 323 None 10
ENSDART00000137012 Essential Splice Site 669 1453 15 36

The following transcripts of ENSDARG00000061249 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30649968)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30951603
GRCz11 2 30935136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGTGGTGTGTGGGCTCCCTGCAACAATAAGCCAGTCAAAGGCACGAG[G/A]TATGCCAAATGTGAAATTTTAATAAAACAAGAGAGGGTTTTCTAAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087126 Essential Splice Site 1024 1483 24 37
ENSDART00000131606   None 323 None 10
ENSDART00000137012 Essential Splice Site 1018 1453 24 36

The following transcripts of ENSDARG00000061249 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30663025)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30964660
GRCz11 2 30948193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTCAGGTGCACAAAACAGGTATATGTTAACTGTGACCAATTTTCTGC[A/T]GTAATTCCTTTCAAAAGTGAAATGGCCATTGAGCTGCAGGAGAAGGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087126 Nonsense 1071 1483 25 37
ENSDART00000131606   None 323 None 10
ENSDART00000137012 Nonsense 1065 1453 25 36

The following transcripts of ENSDARG00000061249 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30663283)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30964918
GRCz11 2 30948451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTGATCATATTTTGTTATTTTTGTTTATCAAACACTTTCAGAAGTA[C/A]ACAATGAACTTTAACAAGAGCACTGGCATCATTGAGATGTTTATGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087126 Nonsense 1322 1483 33 37
ENSDART00000131606 Nonsense 162 323 6 10
ENSDART00000137012 Nonsense 1292 1453 32 36

The following transcripts of ENSDARG00000061249 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 30667790)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30969425
GRCz11 2 30952958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAAAGATCTCCCACTCAGACAGAGTCCAGTGTGGTGTCACCGGAGAA[C/T]AGCTGTGGCTCAAAATTAACGAGCCCACCGAGAAGGATAAGGGCAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link