zgc:153955

Ensembl ID:
ENSDARG00000061242
ZFIN ID:
ZDB-GENE-061103-184
Description:
tuftelin [Source:RefSeq peptide;Acc:NP_001073470]
Human Orthologue:
TUFT1
Human Description:
tuftelin 1 [Source:HGNC Symbol;Acc:12422]
Mouse Orthologue:
Tuft1
Mouse Description:
tuftelin 1 Gene [Source:MGI Symbol;Acc:MGI:109572]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32087 Essential Splice Site Available for shipment Available now
sa42710 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087144 Essential Splice Site 361 384 11 12
Genomic Location (Zv9):
Chromosome 16 (position 24546213)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22450529
GRCz11 16 22365919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCAAATTCATTCCTGCCATCAGACAGCAATGCGCAGATTGTCTACAG[G/A]TAAGACATGCAAACGGTCCCGATAGCTGTACGCAAATGTTTTCATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087144 Nonsense 362 384 12 12
Genomic Location (Zv9):
Chromosome 16 (position 24546089)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22450405
GRCz11 16 22365795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCACAAGAACACCCATTAAGTCAAATCATATGTTTGTCTTTTTACAGC[A/T]AACCTCTCAGACCATCCAGCCAAAGCAACAAGAGTCTGCCCTTCATCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link