zgc:158651

Ensembl ID:
ENSDARG00000061215
ZFIN ID:
ZDB-GENE-070112-2102
Description:
Protein FAM149B1 [Source:UniProtKB/Swiss-Prot;Acc:A1L253]
Human Orthologue:
FAM149B1
Human Description:
family with sequence similarity 149, member B1 [Source:HGNC Symbol;Acc:29162]
Mouse Orthologue:
Fam149b
Mouse Description:
family with sequence similarity 149, member B Gene [Source:MGI Symbol;Acc:MGI:2145567]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36425 Nonsense Mutation detected in F1 DNA During 2018
sa6478 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087062 Nonsense 393 644 9 15
ENSDART00000127224 Nonsense 416 667 10 16
Genomic Location (Zv9):
Chromosome 17 (position 26438110)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26578029
GRCz11 17 26596420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCATTCCACTGCAGCAAAGGAACCTGGGAACTCTGGACCGATTAAAT[C/T]AGTATGAACCACACAGAAACACAAATAGATACAGCGTTTACTGTGTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087062 Nonsense 445 644 10 15
ENSDART00000127224 Nonsense 468 667 11 16
Genomic Location (Zv9):
Chromosome 17 (position 26436528)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26576447
GRCz11 17 26594838
KASP Assay ID:
554-4576.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTTTGACTCGCCCCCCTCAGTCTGCACGGCGACGGAACCCACCTCCT[C/T]GAAATCTGATGCCAATTACGTCCAGCGTAACACAGCCAATCACAACCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link