zgc:158419

Ensembl ID:
ENSDARG00000061213
ZFIN ID:
ZDB-GENE-070112-572
Description:
rab GTPase-binding effector protein 2 [Source:RefSeq peptide;Acc:NP_001074094]
Human Orthologue:
RABEP2
Human Description:
rabaptin, RAB GTPase binding effector protein 2 [Source:HGNC Symbol;Acc:24817]
Mouse Orthologue:
Rabep2
Mouse Description:
rabaptin, RAB GTPase binding effector protein 2 Gene [Source:MGI Symbol;Acc:MGI:1917564]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15994 Essential Splice Site Available for shipment Available now
sa2121 Nonsense F2 line generated During 2018
sa1964 Nonsense F2 line generated During 2018
sa38390 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087064 Essential Splice Site 19 483 None 14
ENSDART00000113890 Essential Splice Site 19 483 None 13
Genomic Location (Zv9):
Chromosome 3 (position 26863684)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26040552
GRCz11 3 26171423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCGGACACGNNNACRACAGCAGCCGCGTCGCGCAGTGACGAGCGTGACGG[T/C]ATGAACAACCGCTACATTATTACAGTCTGTCTSTGTKTGAAGTGTCGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2121
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087064 Nonsense 288 483 6 14
ENSDART00000113890 Nonsense 288 483 6 13
Genomic Location (Zv9):
Chromosome 3 (position 26870471)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26033765
GRCz11 3 26164636
KASP Assay ID:
554-3278.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAAGATCTACAGAAATCTTTTAGCATGTCACAAAATGCTGTTCAGTG[C/A]AGATTGGTGAGYAGCATGTGACTRAACCAATYAGAAGCTAGCATTAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1964
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087064 Nonsense 298 483 7 14
ENSDART00000113890 Nonsense 298 483 7 13
Genomic Location (Zv9):
Chromosome 3 (position 26870618)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26033618
GRCz11 3 26164489
KASP Assay ID:
554-0293.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTTCTTTGTGCATTTTCTCCACTCAGGCAGAGCTGTCTTACTCGCAG[A/T]AGAGAGTCTGTAATGAACTCTCCAAGCTGAAGGGAGAAGACGGTGACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087064 Essential Splice Site None 483 None 14
ENSDART00000113890   None 483 13 13
Genomic Location (Zv9):
Chromosome 3 (position 26877591)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26026645
GRCz11 3 26157516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACATGGAAAATGTGCAGAGCTGGTGGTCCTCCAGGAACTTGGTTGAGA[A/G]ACACTGCTTTAGAGTAAATTCATTATGACTTTGCACAGCATAAGTGCATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link