zgc:153460

Ensembl ID:
ENSDARG00000061207
ZFIN ID:
ZDB-GENE-070105-3
Description:
tetratricopeptide repeat protein 7B [Source:RefSeq peptide;Acc:NP_001074072]
Human Orthologue:
TTC7B
Human Description:
tetratricopeptide repeat domain 7B [Source:HGNC Symbol;Acc:19858]
Mouse Orthologue:
Ttc7b
Mouse Description:
tetratricopeptide repeat domain 7B Gene [Source:MGI Symbol;Acc:MGI:2144724]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2911 Essential Splice Site F2 line generated During 2018
sa16905 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2911
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087023 Essential Splice Site 41 844 1 20

The following transcripts of ENSDARG00000061207 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 26453850)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26593769
GRCz11 17 26612160
KASP Assay ID:
554-2921.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATACCAGAGCTCGTGCGGCAGCTGTCGGCRAAACTCATCTCCAACGG[T/C]GAGAGTGATTTATCTTTATTTTCTCATGGCTAACGCGTTAGCTCGGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087023 Nonsense 541 844 15 20

The following transcripts of ENSDARG00000061207 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 26499519)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26639438
GRCz11 17 26657829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTANNTGTRTGTGTGTGTCAGATTCCAGAAGCGCTCGGTTAKGTACGA[C/T]AGGCGTTACAGCTGCAGGGTGAYGATGTTCACTCGCTGCACCTGCTGGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link