
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153460
- Ensembl ID:
- ENSDARG00000061207
- ZFIN ID:
- ZDB-GENE-070105-3
- Description:
- tetratricopeptide repeat protein 7B [Source:RefSeq peptide;Acc:NP_001074072]
- Human Orthologue:
- TTC7B
- Human Description:
- tetratricopeptide repeat domain 7B [Source:HGNC Symbol;Acc:19858]
- Mouse Orthologue:
- Ttc7b
- Mouse Description:
- tetratricopeptide repeat domain 7B Gene [Source:MGI Symbol;Acc:MGI:2144724]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2911 | Essential Splice Site | F2 line generated | During 2018 |
sa16905 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa2911
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087023 | Essential Splice Site | 41 | 844 | 1 | 20 |
The following transcripts of ENSDARG00000061207 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 17 (position 26453850)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 26593769 GRCz11 17 26612160 - KASP Assay ID:
- 554-2921.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAATACCAGAGCTCGTGCGGCAGCTGTCGGCRAAACTCATCTCCAACGG[T/C]GAGAGTGATTTATCTTTATTTTCTCATGGCTAACGCGTTAGCTCGGACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16905
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087023 | Nonsense | 541 | 844 | 15 | 20 |
The following transcripts of ENSDARG00000061207 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 17 (position 26499519)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 26639438 GRCz11 17 26657829 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGTANNTGTRTGTGTGTGTCAGATTCCAGAAGCGCTCGGTTAKGTACGA[C/T]AGGCGTTACAGCTGCAGGGTGAYGATGTTCACTCGCTGCACCTGCTGGCC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cytomegalovirus antibody response: Genome-wide association study does not reveal major genetic determinants for anti-cytomegalovirus antibody response. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: