stag1

Ensembl ID:
ENSDARG00000061205
ZFIN ID:
ZDB-GENE-070912-448
Description:
Novel protein similar to vertebrate stromal antigen 1 (STAG1) [Source:UniProtKB/TrEMBL;Acc:B0V0X2]
Human Orthologue:
STAG1
Human Description:
stromal antigen 1 [Source:HGNC Symbol;Acc:11354]
Mouse Orthologue:
Stag1
Mouse Description:
stromal antigen 1 Gene [Source:MGI Symbol;Acc:MGI:1098658]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13423 Nonsense Available for shipment Available now
sa25109 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17076 Nonsense Available for shipment Available now
sa19759 Essential Splice Site Available for shipment Available now
sa12166 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088110 Nonsense 369 1278 11 34
ENSDART00000142601 Nonsense 350 1251 11 33
Genomic Location (Zv9):
Chromosome 2 (position 24853283)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25428060
GRCz11 2 25083694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGTCAGAACTTTCTTGTTTTCCAGCAAGGTGAAGTGCGCTTGAAGTG[T/A]TTGAAAGCCTTACAAAACCTTTACACAAACCGTGAACTGTTTCCAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088110 Essential Splice Site 570 1278 17 34
ENSDART00000142601 Essential Splice Site 551 1251 17 33
Genomic Location (Zv9):
Chromosome 2 (position 24856595)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25431372
GRCz11 2 25087006
KASP Assay ID:
554-7826.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGTTTCTTTAAAACCCAAAAGGTATTCAGTTTAGTCTATTATTATGC[A/T]GGTCTTGACTGCGAAAGAAAGGAAGATGCAGATTGATGACAAAAACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088110 Nonsense 616 1278 18 34
ENSDART00000142601 Nonsense 597 1251 18 33
Genomic Location (Zv9):
Chromosome 2 (position 24856820)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25431597
GRCz11 2 25087231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGTACCAGACAGAWTCAGAGAAAGTAGCCAATCTTCWKCAGATCCCA[C/T]AGTACTTTGACCTGGACGTGTACAGCGCTGGGAGAATGGAGAAGGTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088110 Essential Splice Site 630 1278 18 34
ENSDART00000142601 Essential Splice Site 611 1251 18 33
Genomic Location (Zv9):
Chromosome 2 (position 24856866)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25431643
GRCz11 2 25087277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACAGTACTTTGACCTGGACGTGTACAGCGCTGGGAGAATGGAGAAGG[T/A]GAGATGTTTCTTCATCTATATCTGCTTTGTCTACACCCCATGACACTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088110 Essential Splice Site 1110 1278 29 34
ENSDART00000142601 Essential Splice Site 1090 1251 29 33
Genomic Location (Zv9):
Chromosome 2 (position 24869718)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25444495
GRCz11 2 25100129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATACGCAGCAAGAAGGGCCGACCGCCRCYGCACAAGAAACGCATTGAGG[G/T]TTAGCACGACACCACMCATACTCMTRCTGACATRCACAGGTGTAAAAYAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link