trpc1

Ensembl ID:
ENSDARG00000061203
ZFIN ID:
ZDB-GENE-070830-1
Description:
short transient receptor potential channel 1 [Source:RefSeq peptide;Acc:NP_001185590]
Human Orthologue:
TRPC1
Human Description:
transient receptor potential cation channel, subfamily C, member 1 [Source:HGNC Symbol;Acc:12333]
Mouse Orthologue:
Trpc1
Mouse Description:
transient receptor potential cation channel, subfamily C, member 1 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37817 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087034 Nonsense 292 766 6 12
ENSDART00000139191 Nonsense 322 796 7 13
Genomic Location (Zv9):
Chromosome 24 (position 5934913)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5822205
GRCz11 24 5851534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTTGGTAATATGTTTTGTCATCTTCCCTCCTCCACAGTTTGTCGCC[C/T]AATCCAACTGTCAGCAGTTTCTGAATACGGTGTGGTTTGGCGAGATGGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link