
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
emilin2a
- Ensembl ID:
- ENSDARG00000061196
- ZFIN ID:
- ZDB-GENE-060503-247
- Human Orthologue:
- EMILIN2
- Human Description:
- elastin microfibril interfacer 2 [Source:HGNC Symbol;Acc:19881]
- Mouse Orthologue:
- Emilin2
- Mouse Description:
- elastin microfibril interfacer 2 Gene [Source:MGI Symbol;Acc:MGI:2389136]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32947 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa719 | Essential Splice Site | Available for shipment | Available now |
sa718 | Essential Splice Site | Available for shipment | Available now |
sa9754 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32947
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087026 | Nonsense | 41 | 1024 | 1 | 8 |
ENSDART00000140841 | Nonsense | 75 | 776 | 2 | 4 |
ENSDART00000148157 | None | 155 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 30732152)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 31033787 GRCz11 2 31017320 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGAACCTGAAGCCGCGCGCTGTCCTGAGCACCAGCCTGACTGTGAGCCA[C/T]AAATGATGTAAGTCCTCGAGAGACCGGGAGGGGCGTGTGGTGGAAACACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa719
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087026 | Essential Splice Site | 117 | 1024 | 2 | 8 |
ENSDART00000140841 | None | 776 | None | 4 | |
ENSDART00000148157 | None | 155 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 30728306)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 31029941 GRCz11 2 31013474 - KASP Assay ID:
- 554-0627.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCGAACTGCACAAAGTATGGAATCTTTCACAATGATTGCATGTTRTTTCT[G/A]TATGTTCTAATGCATGTATTCATTTTTTAGGTTTAAATGATCTTAATGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa718
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087026 | Essential Splice Site | 118 | 1024 | 3 | 8 |
ENSDART00000140841 | None | 776 | None | 4 | |
ENSDART00000148157 | None | 155 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 30728241)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 31029876 GRCz11 2 31013409 - KASP Assay ID:
- 554-0626.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTATTCATTTTTTAGGTTTAAATGATCTTAATGGTGATTTGTTTCTATA[C/T]GTTTCGTTACCACAGGACCAGAGCGGCGGGAAACTGTACAATATGACTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9754
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000087026 | Nonsense | 993 | 1024 | 8 | 8 |
ENSDART00000140841 | None | 776 | None | 4 | |
ENSDART00000148157 | Nonsense | 124 | 155 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 30701925)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 31003560 GRCz11 2 30987093 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCGTCTTTCAGCCTCATYCTYCCKCTCCACAGAGGTGACACCRTGGCCT[T/A]GGTCCGCACTGCTGGTAAGCTGGCGGTCTCYGAATCAAGAGAGATCCTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: