vps45

Ensembl ID:
ENSDARG00000061180
ZFIN ID:
ZDB-GENE-060503-526
Description:
Novel protein similar to vertebrate vacuolar protein sorting 45A (Yeast) (VPS45A) [Source:UniProtKB/
Human Orthologue:
VPS45
Human Description:
vacuolar protein sorting 45 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:14579]
Mouse Orthologue:
Vps45
Mouse Description:
vacuolar protein sorting 45 (yeast) Gene [Source:MGI Symbol;Acc:MGI:891965]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14216 Nonsense Available for shipment Available now
sa45682 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086961 Nonsense 9 568 1 15
Genomic Location (Zv9):
Chromosome 19 (position 43937312)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42847114
GRCz11 19 42416551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGAATATATATANNAAACGCCAAAATGAACGTGACTCTTGCTGTRAAA[C/T]AGTACATTTCCAAAATGATAGAGAGCAGCGGACCTGGGATGAAGGTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086961 Essential Splice Site 312 568 9 15
Genomic Location (Zv9):
Chromosome 19 (position 43926189)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42835991
GRCz11 19 42405428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAAACCCAAGGACCAACAGAAGTTAGAGTCTATATCTGACATGAAGG[T/C]GAGTGGAGCACTGCTGAACTTAAATTAATACTCTTCACTGTAGCACATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link