st14a

Ensembl ID:
ENSDARG00000061173
ZFIN ID:
ZDB-GENE-030131-6496
Description:
matriptase [Source:RefSeq peptide;Acc:NP_001035441]
Human Orthologue:
ST14
Human Description:
suppression of tumorigenicity 14 (colon carcinoma) [Source:HGNC Symbol;Acc:11344]
Mouse Orthologue:
St14
Mouse Description:
suppression of tumorigenicity 14 (colon carcinoma) Gene [Source:MGI Symbol;Acc:MGI:1338881]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39215 Nonsense Mutation detected in F1 DNA During 2018
sa23372 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086952 Nonsense 514 834 15 20
ENSDART00000098558 Nonsense 507 827 15 20
ENSDART00000121994   None 233 None 7
ENSDART00000135386   None 191 None 6
ENSDART00000140672   None 77 None 3
Genomic Location (Zv9):
Chromosome 18 (position 42974128)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44564019
GRCz11 18 44557473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTGTTTGACATAGTTGTTCTCTTTTCTGGCAGGATGTAGAGCTGAT[C/T]AATTTAAGTGCAAGAACGATAAATGCATCTCAGAGAAGCAGAAGTGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086952 Essential Splice Site 737 834 18 20
ENSDART00000098558 Essential Splice Site 730 827 18 20
ENSDART00000121994 Essential Splice Site 136 233 5 7
ENSDART00000135386   None 191 None 6
ENSDART00000140672   None 77 None 3
Genomic Location (Zv9):
Chromosome 18 (position 42977096)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44566987
GRCz11 18 44560441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGGACATCTGTCTTTATCAGTGGCTGGGGCGCCACTAGAGAAGGAGG[T/G]CAGCAAAAAAGCTTAGAACTCATAACTTTGTCCTGGTGTGTGATTTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link