wu:fc76b04

Ensembl ID:
ENSDARG00000061169
ZFIN ID:
ZDB-GENE-030131-4154
Description:
Wu:fc76b04 protein [Source:UniProtKB/TrEMBL;Acc:B3DLG3]
Human Orthologue:
LARP1B
Human Description:
La ribonucleoprotein domain family, member 1B [Source:HGNC Symbol;Acc:24704]
Mouse Orthologues:
Larp1b, Larp1b
Mouse Descriptions:
La ribonucleoprotein domain family, member 1B Gene [Source:MGI Symbol;Acc:MGI:1914604]
La ribonucleoprotein domain family, member 1B Gene [Source:MGI Symbol;Acc:MGI:1914604]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42944 Nonsense Mutation detected in F1 DNA During 2018
sa42945 Nonsense Mutation detected in F1 DNA During 2018
sa1234 Nonsense Available for shipment Available now
sa9587 Nonsense Available for shipment Available now
sa12850 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025096 Nonsense 21 1076 1 18
Genomic Location (Zv9):
Chromosome 17 (position 26596091)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26736010
GRCz11 17 26754401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTGCGAGCGACTTGGACGTGACAATCGGTTGTTTGGGCGAAGGGAAC[C/T]AAAACAAGTCGGACGCGGATCGACCCGAGCAAGCTGACCGAACCACGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025096 Nonsense 509 1076 9 18
Genomic Location (Zv9):
Chromosome 17 (position 26623715)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26763634
GRCz11 17 26782025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCAGTCTCTCTGATCCAGATGCACAGCCGTGGATACAGGTGGAGAAA[C/T]GACACAGAAACACATCTGGGAAAAATAAGGTACTTCTGGATCCACTAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025096 Nonsense 710 1076 12 18
Genomic Location (Zv9):
Chromosome 17 (position 26632732)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26772651
GRCz11 17 26791042
KASP Assay ID:
554-1143.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCATCCAGTGTGCCTAGAACCCCACGTACACCTCGTACACCTGGAAGA[C/T]AAGATCCCACCAAAACCCCACGGTTCTACCCTGTCATTAAAGAAGACAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025096 Nonsense 948 1076 17 18
Genomic Location (Zv9):
Chromosome 17 (position 26642513)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26782432
GRCz11 17 26800823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCCAAACTCAAGGAGTACCTCAGCAAATTTAAGAGCATTGATGATTTC[A/T]GAGTAGAAGTRAGTATAAGAATCAGCTGTACGTGAATATCTCTTGCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025096 Nonsense 983 1076 18 18
Genomic Location (Zv9):
Chromosome 17 (position 26642760)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26782679
GRCz11 17 26801070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAGATGAGGTGAAACGTAGACGACACAACTCGACTTCRTCATCGAAA[C/T]AGACCCAAATCACCAAGACCTCCTCAGACAATCAGACGACCGCAAAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link