slc6a4a

Ensembl ID:
ENSDARG00000061165
ZFIN ID:
ZDB-GENE-060314-1
Description:
sodium-dependent serotonin transporter [Source:RefSeq peptide;Acc:NP_001035061]
Human Orthologue:
SLC6A4
Human Description:
solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Slc6a4
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 Gene [Source:MGI Symbol;

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17033 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086902 Nonsense 248 646 4 13

The following transcripts of ENSDARG00000061165 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 27964572)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28682812
GRCz11 15 28615688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGWGTACCTTGATAAACTGCAAACCAACTTCTTTCTTGTCCTTAGCCGG[C/T]AGGTGTTGCAGGTTCATCTATCYCCTGGTCTTCATCAACTGGGCTGGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link