wu:fo94f09

Ensembl ID:
ENSDARG00000061147
ZFIN ID:
ZDB-GENE-031118-80
Description:
Wu:fo94f09 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLQ7]
Human Orthologue:
ZFP64
Human Description:
zinc finger protein 64 homolog (mouse) [Source:HGNC Symbol;Acc:15940]
Mouse Orthologue:
Zfp64
Mouse Description:
zinc finger protein 64 Gene [Source:MGI Symbol;Acc:MGI:107342]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37772 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086879 Nonsense 563 666 6 6
Genomic Location (Zv9):
Chromosome 23 (position 38920912)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 38885983
GRCz11 23 38817709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTTCAGCGTCTGCTTCTGAAGCCACGCACACCTTCATTACATCCTG[T/A]TCTGACCTGGAAAGCCTCCATAAGCTCATCCAGGAGGGTGGGACTGAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Amyotrophic lateral sclerosis: Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link