erbb4b

Ensembl ID:
ENSDARG00000061142
ZFIN ID:
ZDB-GENE-030918-5
Description:
Novel protein similar to vertebrate v-erb-a erythroblastic leukemia viral oncogene homolog 4 (Avian)
Human Orthologue:
ERBB4
Human Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) [Source:HGNC Symbol;Acc:3432]
Mouse Orthologue:
Erbb4
Mouse Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) Gene [Source:MGI Symbol;Acc:MGI:104

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45369 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21550 Essential Splice Site Available for shipment Available now
sa41494 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41495 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100398 Essential Splice Site 118 563 4 14
ENSDART00000147135 Essential Splice Site 351 740 9 18
Genomic Location (Zv9):
Chromosome 9 (position 40490671)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39622789
GRCz11 9 39433127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGTGTCTTCTCCAATCTGGCAACTATTGGAGGCAGAGCTCTCTACAG[G/A]TAATGCGCATTGCTTGGTATTTGCTGCCAGCTCTTGAACTAATACCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100398 Essential Splice Site 312 563 8 14
ENSDART00000147135 Essential Splice Site 545 740 13 18
Genomic Location (Zv9):
Chromosome 9 (position 40523521)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39589939
GRCz11 9 39400277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGGCCAACAATGAGTGTCACCCCTGCCATGTCAACTGCACCCAGGGG[T/C]ATGGATAGCTTTGTTAAATGTTTGCAATGTGTGTGTGTGTGTTGGGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100398 Essential Splice Site 371 563 10 14
ENSDART00000147135 Essential Splice Site 604 740 15 18
Genomic Location (Zv9):
Chromosome 9 (position 40542234)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39571226
GRCz11 9 39381564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAAGCATCAAGAAGAAGAGAGCATTGAGGCGCTTCTTGGAGACCGAG[G/A]TTAGGCATGGTCTATCTTCTTTTGCTGTTATTTACTCTTTTTTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100398 Nonsense 393 563 11 14
ENSDART00000147135 Nonsense 626 740 16 18
Genomic Location (Zv9):
Chromosome 9 (position 40546791)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39566669
GRCz11 9 39377007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCCCCAGCGGTGCAGCCCCAAATCAGGCCCAACTGCGCATTCTGAAA[G/T]AGACGGAGCTGAAACGGGTGAAGATCCTGGGAGCCGGAGCCTTTGGCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link