aldh18a1

Ensembl ID:
ENSDARG00000061123
ZFIN ID:
ZDB-GENE-030131-5602
Description:
aldehyde dehydrogenase 18A1 [Source:RefSeq peptide;Acc:NP_001077015]
Human Orthologue:
ALDH18A1
Human Description:
aldehyde dehydrogenase 18 family, member A1 [Source:HGNC Symbol;Acc:9722]
Mouse Orthologue:
Aldh18a1
Mouse Description:
aldehyde dehydrogenase 18 family, member A1 Gene [Source:MGI Symbol;Acc:MGI:1888908]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35325 Nonsense Mutation detected in F1 DNA During 2018
sa27981 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086810 Nonsense 272 784 7 17
ENSDART00000112890   None 782 None 18
ENSDART00000142988   None 752 None 16
Genomic Location (Zv9):
Chromosome 12 (position 32461551)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGGGTCAGACGATGCCAAGCTTTTGGACACATTTTACCCTGGAGAC[C/T]AACAATCAATAACCTATGGCACAAAGTCTAGGGTCGGCATCGGAGGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086810   None 784 None 17
ENSDART00000112890 Nonsense 181 782 6 18
ENSDART00000142988 Nonsense 151 752 4 16
Genomic Location (Zv9):
Chromosome 12 (position 32483423)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30681420
GRCz11 12 30796322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATCAGATCCTGGTAACAAACCTAGACTTCCACGACGAACAGAAAAGA[C/T]GAAACTTGAATAGCACTCTGTACGAGCTGCTGCGAATGAACATCGTTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link