zgc:153779

Ensembl ID:
ENSDARG00000061117
ZFIN IDs:
ZDB-GENE-061103-343, ZDB-GENE-061103-343
Description:
arf-GAP with GTPase, ANK repeat and PH domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_00
Human Orthologue:
AGAP2
Human Description:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:16921]
Mouse Orthologue:
Agap2
Mouse Description:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 2 Gene [Source:MGI Symbol;Acc:MGI:3580016]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44036 Nonsense Mutation detected in F1 DNA During 2018
sa37768 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12289 Nonsense Available for shipment Available now
sa44035 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32463 Nonsense Available for shipment Available now
sa8589 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086813 Nonsense 286 827 8 18
ENSDART00000125104 Nonsense 286 827 8 18
Genomic Location (Zv9):
Chromosome 23 (position 36743334)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36574811
GRCz11 23 36697272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTAGCGACTACCCCTCGTCTCTGCCTTCTACCCCTGTGATTAGTCAC[A/T]AAGACATACGGGGTGGAGCGAGTGGAGACGGGGTCACACAGCGAAACCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086813 Essential Splice Site 312 827 9 18
ENSDART00000125104 Essential Splice Site 312 827 9 18
Genomic Location (Zv9):
Chromosome 23 (position 36741252)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36572729
GRCz11 23 36695190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCCACTTTTGTTTTATTCGTACTTTATTTAACATGTCTGCTATTGT[A/G]GAATCGGCGTGGCAGTGACTCTGAGAAAAGATCTTCAGATAGCAGAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086813 Nonsense 320 827 9 18
ENSDART00000125104 Nonsense 320 827 9 18
Genomic Location (Zv9):
Chromosome 23 (position 36741226)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36572703
GRCz11 23 36695164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTRTTTAACATGTCTGCTATTGTAGAATCGGCGTGGCAGTGACTCTGAG[A/T]AAAGATCTTCAGATAGCAGAAGTGACACGAGCCGGTCAGTCCCTATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086813 Essential Splice Site 515 827 13 18
ENSDART00000125104 Essential Splice Site 515 827 13 18
Genomic Location (Zv9):
Chromosome 23 (position 36734221)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36565698
GRCz11 23 36688159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCGAAGTATTAATCTGAAAGGAGATGCAGCGGCCGGTCAGGCTGAAG[G/T]TAGCAGACCGTACCATTGATCTACTATCACTGATAATAAAGCCATCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086813 Nonsense 584 827 15 18
ENSDART00000125104 Nonsense 584 827 15 18
Genomic Location (Zv9):
Chromosome 23 (position 36727940)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36559417
GRCz11 23 36681878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGAACAGCCAAAGTGAAGCTGTTGCCCTGCAGGCCATTCGAAACGCC[A/T]AAGGGAACGACCTCTGTGTGGACTGTGCAGCACCAAGTAAGCCTGTCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086813 Nonsense 680 827 17 18
ENSDART00000125104 Nonsense 680 827 17 18
Genomic Location (Zv9):
Chromosome 23 (position 36725953)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36557430
GRCz11 23 36679891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTATTTTGTGTTGGTCTCAGAGAGCAGAGGGAGTCGTGGATCCGTGCC[A/T]AATACGAACAGCGAGCRTTTGTGTCGCCCTTGCCTGCTCAGTGTTCAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link