snx19a

Ensembl ID:
ENSDARG00000061101
ZFIN ID:
ZDB-GENE-060526-204
Description:
sorting nexin 19a [Source:RefSeq peptide;Acc:NP_001124114]
Human Orthologue:
SNX19
Human Description:
sorting nexin 19 [Source:HGNC Symbol;Acc:21532]
Mouse Orthologue:
Snx19
Mouse Description:
sorting nexin 19 Gene [Source:MGI Symbol;Acc:MGI:1921581]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40461 Nonsense Mutation detected in F1 DNA During 2018
sa20450 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086775 Nonsense 95 913 1 11
ENSDART00000148039 Nonsense 95 883 1 11
Genomic Location (Zv9):
Chromosome 5 (position 32019326)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29780156
GRCz11 5 30380309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCTACGCAAGTTCACACTGCCTCAGAGAGCGAACAAAGGTTGGACTG[G/A]GAGATTCAGAGTGCTGTTGACAAGGCTGTGCGGGACTTTGTGACATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086775 Nonsense 657 913 5 11
ENSDART00000148039 Nonsense 657 883 5 11
Genomic Location (Zv9):
Chromosome 5 (position 32016745)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29777575
GRCz11 5 30377728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCATTTCCACGCTCAGAGCCCCAGAGCCCCACAGAGGAAGGAGACCCA[C/T]AAAGAAAGTGAGAAAGCATAAGAAAGCATGTAGATATCATAAGTAAAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link