zgc:171281

Ensembl ID:
ENSDARG00000061096
ZFIN IDs:
ZDB-GENE-080402-8, ZDB-GENE-080402-8
Description:
death-associated protein kinase 3-like [Source:RefSeq peptide;Acc:NP_001116536]
Human Orthologue:
DAPK2
Human Description:
death-associated protein kinase 2 [Source:HGNC Symbol;Acc:2675]
Mouse Orthologue:
Dapk2
Mouse Description:
death-associated protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1341297]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34086 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086753 Nonsense 6 484 2 10
ENSDART00000114205 Nonsense 6 452 1 10
ENSDART00000130577 Nonsense 6 420 2 11
Genomic Location (Zv9):
Chromosome 7 (position 30627676)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29020018
GRCz11 7 29291168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTTTATCTAATTACATTTTTTAAAAGATCACAATGGCTGTGTTCAAA[C/T]AGCAGCAGGTCGAGGATTTCTTTGAGATTGGAGAGGAACTTGGGAGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link