stk36

Ensembl ID:
ENSDARG00000061095
ZFIN ID:
ZDB-GENE-030912-6
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BFU1]
Human Orthologue:
STK36
Human Description:
serine/threonine kinase 36 [Source:HGNC Symbol;Acc:17209]
Mouse Orthologue:
Stk36
Mouse Description:
serine/threonine kinase 36 (fused homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920831]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38479 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11597 Essential Splice Site Available for shipment Available now
sa25300 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086765 Essential Splice Site 315 1231 7 20
ENSDART00000136101   None 119 None 2
ENSDART00000146167 Essential Splice Site 315 500 7 11

The following transcripts of ENSDARG00000061095 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 32038765)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29799595
GRCz11 5 30399748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCGGCAAAGCCAGAGAGCTTCGAGAGAAAGAGAAGACTAACAGACGGG[T/C]AAACTGAAACAACATCTGGAAACAACAGCAGGAACAAACAAAAACTGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086765 Essential Splice Site 613 1231 15 20
ENSDART00000136101   None 119 None 2
ENSDART00000146167   None 500 None 11

The following transcripts of ENSDARG00000061095 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 32044875)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29805705
GRCz11 5 30405858
KASP Assay ID:
2259-5973.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCCTGTGTGATGGCCTTCTGTCACTGATTCTCCACAGGCTAGCTGAGG[T/A]AATTTCTCTYTGATTAATTCCTCTCAAATCTGCGCTGGGCTAATTAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086765 Essential Splice Site 753 1231 18 20
ENSDART00000136101   None 119 None 2
ENSDART00000146167   None 500 None 11

The following transcripts of ENSDARG00000061095 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 32048006)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29808836
GRCz11 5 30408989
KASP Assay ID:
554-7772.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTCTCCAGTCATATCAAAGCTCAAATATTGTTGCAGGTCTAGTACAG[G/A]TATGGTTTATTAATATGCTCCACGATTTTCAGAAGTCATTTTGAGAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link