si:dkey-252h13.1

Ensembl ID:
ENSDARG00000061093
ZFIN ID:
ZDB-GENE-060526-272
Description:
Novel protein similar to vertebrate pleckstrin homology-like domain, family B, member 1 (PHLDB1) [So
Human Orthologue:
PHLDB1
Human Description:
pleckstrin homology-like domain, family B, member 1 [Source:HGNC Symbol;Acc:23697]
Mouse Orthologue:
Phldb1
Mouse Description:
pleckstrin homology-like domain, family B, member 1 Gene [Source:MGI Symbol;Acc:MGI:2143230]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20452 Essential Splice Site Available for shipment Available now
sa40463 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33627 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086734 Essential Splice Site 873 1424 12 25
ENSDART00000138464 Essential Splice Site 873 1365 12 23
Genomic Location (Zv9):
Chromosome 5 (position 32091055)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29851885
GRCz11 5 30452038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAAGAATGGCCAAAGATAGAACCCTGGCCCTGCAGATGCTCCACAAG[G/A]TTGAGTATAAGGATTAACATCTGTCTACACTGATGTTTGACACTTAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086734 Essential Splice Site 1227 1424 None 25
ENSDART00000138464 Essential Splice Site 1168 1365 None 23
Genomic Location (Zv9):
Chromosome 5 (position 32076738)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29837568
GRCz11 5 30437721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTGAAGGAGGCCCAGCAGGAGAAAGCCAGACTGGTGGAGAGTCGAG[T/C]GAGCGCCATTAAACTTTAATTGTCTGTGAAATATAATCTATCTTTCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086734 Essential Splice Site 1378 1424 24 25
ENSDART00000138464 Essential Splice Site 1319 1365 22 23
Genomic Location (Zv9):
Chromosome 5 (position 32066630)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29827460
GRCz11 5 30427613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGGCCATAGAAGAGGTGTATTACGATCACCTGCGCAGCGCCACGAAG[G/A]TAAAAACCGAAAAGCCCTCCTGTTTACCATCAACAGCTCCAGCTCGCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link