zgc:153351

Ensembl ID:
ENSDARG00000061067
ZFIN ID:
ZDB-GENE-061013-562
Description:
transmembrane protein 106C [Source:RefSeq peptide;Acc:NP_001070764]
Human Orthologue:
TMEM106C
Human Description:
transmembrane protein 106C [Source:HGNC Symbol;Acc:28775]
Mouse Orthologue:
Tmem106c
Mouse Description:
transmembrane protein 106C Gene [Source:MGI Symbol;Acc:MGI:1196384]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24228 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086651 Nonsense 94 274 5 9
Genomic Location (Zv9):
Chromosome 23 (position 141579)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1616103
GRCz11 3 1336222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGCTCAGACTCGTGATTGTCCACTTCCTCTCTCTGCAGGAAGCTGTA[T/A]GTGGTGCTGTCAGTAATTCTGTGTCTGCTGGCGTCTTTTCTGGTGGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link