vezf1

Ensembl ID:
ENSDARG00000061030
ZFIN ID:
ZDB-GENE-060825-121
Description:
vascular endothelial zinc finger 1 [Source:RefSeq peptide;Acc:NP_001073432]
Human Orthologue:
VEZF1
Human Description:
vascular endothelial zinc finger 1 [Source:HGNC Symbol;Acc:12949]
Mouse Orthologue:
Vezf1
Mouse Description:
vascular endothelial zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:1313291]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32044 Nonsense Available for shipment Available now
sa15426 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086592 Nonsense 252 460 2 5
Genomic Location (Zv9):
Chromosome 15 (position 30547413)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31369120
GRCz11 15 31249861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTACCATGTGCGCTCGCATGATGGCGGCGTGCACAAGCCCTACATCTG[C/A]TCCGTTTGTGGGAAGGGCTTCTCTAGGTGGGTTTAGCATTTTGGATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086592 Nonsense 277 460 3 5
Genomic Location (Zv9):
Chromosome 15 (position 30546367)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31368074
GRCz11 15 31248815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGCCGGATCATCTTAGCTGTCATGTCAAACATGTACACTCCACAGAA[C/T]GACCCTTTAAATGCCAAGTAACGGTAAGATTGCTCAATAGATTTTTTTNNNGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link