zgc:153107

Ensembl ID:
ENSDARG00000061024
ZFIN ID:
ZDB-GENE-060929-1042
Description:
geranylgeranyl transferase type-2 subunit alpha [Source:RefSeq peptide;Acc:NP_001070131]
Human Orthologue:
RABGGTA
Human Description:
Rab geranylgeranyltransferase, alpha subunit [Source:HGNC Symbol;Acc:9795]
Mouse Orthologue:
Rabggta
Mouse Description:
Rab geranylgeranyl transferase, a subunit Gene [Source:MGI Symbol;Acc:MGI:1860443]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31078 Nonsense Mutation detected in F1 DNA During 2018
sa6721 Nonsense Mutation detected in F1 DNA During 2018
sa12408 Nonsense Available for shipment Available now
sa24239 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099024 Nonsense 12 579 1 15
Genomic Location (Zv9):
Chromosome 23 (position 1729411)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1697596
GRCz11 23 1706453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTTTGATGGTCAGCACGGCCGTGTGAAGGTGAAGACGACAGCGCAG[C/T]AGGAGGAGGAGAAGAGGAAGGAGAGAGAGAAGAAGCTGAAGGCCTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099024 Nonsense 248 579 5 15
Genomic Location (Zv9):
Chromosome 23 (position 1735605)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1703790
GRCz11 23 1712647
KASP Assay ID:
554-4990.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCTTCTTCACYGACCCCAATGACCAGAGCGCYTGGTTCTACTACCGCT[G/A]GCTGCTGGGCAGAGGTGTGTGTCTCTCTTGGTGTGTGCGTGCGTGARTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099024 Nonsense 349 579 9 15
Genomic Location (Zv9):
Chromosome 23 (position 1739628)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1707813
GRCz11 23 1716670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTYTAACCAATAGAGANNGTGTGTGAGTTGTRTGTCTTGTKTTCAGGCTG[T/A]GCTGAAAGCTGGTGTMGAGACTCCGCCACTGATCAGGAGCTGTTCAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099024 Essential Splice Site 424 579 11 15
Genomic Location (Zv9):
Chromosome 23 (position 1742363)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1710548
GRCz11 23 1719405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCTGGGCCATGAGAAAGAGACTCTGACCCATTTTCAAACCCTTAAA[G/A]TAAGACCACGAGAGCCTCGACACTGACCAATTACTATTGACTAATGCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link