si:dkey-7b17.4

Ensembl ID:
ENSDARG00000061017
ZFIN IDs:
ZDB-GENE-030131-5843, ZDB-GENE-060531-154
Description:
Protein spinster homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:A2SWM2]
Human Orthologue:
SPNS2
Human Description:
spinster homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:26992]
Mouse Orthologue:
Spns2
Mouse Description:
spinster homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2384936]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2192 Nonsense F2 line generated During 2018
sa10870 Nonsense Available for shipment Available now
sa20453 Nonsense Available for shipment Available now
sa1096 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa2192
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086564   None 503 None 12
ENSDART00000111749 Nonsense 50 501 1 13
Genomic Location (Zv9):
Chromosome 5 (position 32563042)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30323872
GRCz11 5 30924025
KASP Assay ID:
554-2455.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATCTGCATCACTGCAGACCTGGGCAGAAATTCCATGCCGCATTACTC[C/T]GATGCCGGACTCCGCTTGTAGCCGCCGGGATTCTGAGTTTTGGAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086564 Nonsense 136 503 4 12
ENSDART00000111749 Nonsense 212 501 5 13
Genomic Location (Zv9):
Chromosome 5 (position 32476716)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30237546
GRCz11 5 30837699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRGTCTGGGCTACATCCTGGGATCAATTGCTAAAGATGCTGGAGGGCATT[G/A]GTACTGGGCACTGAGGGTAAGAGCTGCCGAAATGTCTCTGTGTGTTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086564 Nonsense 277 503 7 12
ENSDART00000111749 Nonsense 353 501 8 13
Genomic Location (Zv9):
Chromosome 5 (position 32467464)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30228294
GRCz11 5 30828447
KASP Assay ID:
2259-5990.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACACGACTTTGCCGTCAGAAGACGGAGCGTGCCGACCCGCTGGTGTG[T/A]GCGGTCAGCATGCTGGGTTCTGCCATCTTCATCTGCCTCATCTTTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1096
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086564 Nonsense 385 503 8 12
ENSDART00000111749   None 501 None 13
Genomic Location (Zv9):
Chromosome 5 (position 32463259)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30224089
GRCz11 5 30824242
KASP Assay ID:
554-0998.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCCATAAGCACCTTGAAAATCCAGACCAGACACTTCGGGATATCAGTT[C/A]ATTTGTGTGGGAATGCCGAAGCCAGTTAGTCTGTTCTCRTGGGATTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link