smcr7a

Ensembl ID:
ENSDARG00000060991
ZFIN ID:
ZDB-GENE-060810-64
Description:
Smith-Magenis syndrome chromosomal region candidate gene 7 protein-like [Source:UniProtKB/Swiss-Prot
Human Orthologue:
SMCR7L
Human Description:
Smith-Magenis syndrome chromosome region, candidate 7-like [Source:HGNC Symbol;Acc:25979]
Mouse Orthologue:
Smcr7l
Mouse Description:
Smith-Magenis syndrome chromosome region, candidate 7-like (human) Gene [Source:MGI Symbol;Acc:MGI:2

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45139 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14161 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089325 Essential Splice Site 109 468 4 6
ENSDART00000124731 Essential Splice Site 109 468 2 4
Genomic Location (Zv9):
Chromosome 3 (position 25243606)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25011791
GRCz11 3 25142339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCGCTCATTGCAGACACTGCCCACCTCCTCCAGCTCTTTCAAGCCAG[G/A]TAATGAATCTCTGCTGCCTCGCTGAAACAACATCCTGTGCTTTTGTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089325 Nonsense 399 468 6 6
ENSDART00000124731 Nonsense 399 468 4 4
Genomic Location (Zv9):
Chromosome 3 (position 25239530)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25007715
GRCz11 3 25138263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGGTTRAACGCAAGCCAGCTCACGAATGCAATCCYTCTCCTGAGTGAM[C/T]AGGAGGGCGATTGGACTCAAGAGGCGCTCGCCGACCGTTYCATGCAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link