zgc:154077

Ensembl ID:
ENSDARG00000060987
ZFIN ID:
ZDB-GENE-061110-34
Description:
hypothetical protein LOC777745 [Source:RefSeq peptide;Acc:NP_001071257]
Human Orthologue:
C12orf4
Human Description:
chromosome 12 open reading frame 4 [Source:HGNC Symbol;Acc:1184]
Mouse Orthologue:
D6Wsu163e
Mouse Description:
DNA segment, Chr 6, Wayne State University 163, expressed Gene [Source:MGI Symbol;Acc:MGI:107893]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24637 Nonsense Available for shipment Available now
sa14182 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086495 Nonsense 257 551 7 14
Genomic Location (Zv9):
Chromosome 25 (position 17217457)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16764001
GRCz11 25 16860401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTCAGCGAGGAGATCAAGGTGCAACCGGGTCAGCTTGGAGAGGCT[G/T]GAGAAGCGGCAGATCGACTCTTCGAGGAGCAGCGACAGCTGGAGGAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086495 Nonsense 315 551 8 14
Genomic Location (Zv9):
Chromosome 25 (position 17220333)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16766877
GRCz11 25 16863277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAAGCATCGRCGGCACAGCAGCAGCGGGGTAAAGTTAAGACGACTG[C/T]AAAYTGCACTTTCACTCTACTCCACATCTCTCTGCGGACTAGTGCTGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link