zgc:153972

Ensembl ID:
ENSDARG00000060954
ZFIN ID:
ZDB-GENE-061013-154
Description:
transmembrane and coiled-coil domains protein 1 [Source:RefSeq peptide;Acc:NP_001073477]
Human Orthologue:
TMCC1
Human Description:
transmembrane and coiled-coil domain family 1 [Source:HGNC Symbol;Acc:29116]
Mouse Orthologue:
Tmcc1
Mouse Description:
transmembrane and coiled coil domains 1 Gene [Source:MGI Symbol;Acc:MGI:2442368]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15333 Nonsense Available for shipment Available now
sa21879 Nonsense Available for shipment Available now
sa15188 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086437 Nonsense 89 656 1 5
Genomic Location (Zv9):
Chromosome 11 (position 18635160)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18060191
GRCz11 11 18216723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTCTTCCACAGGCCCCATCCTTGAACCTCCAGAAGTGGGGCCAGAGT[T/A]GGGGGAAGCGCAAGGCATCACGGTCGCCCCTAACTCTGACCCTYACACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086437 Nonsense 494 656 3 5
Genomic Location (Zv9):
Chromosome 11 (position 18610569)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18035600
GRCz11 11 18238162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACTAGAAGAATCTTTTGATAACCTGAAGAGTCACTATCAGAGAGACTA[C/A]ACGGATATTATGCAGGCCTTGCAGGAGGAGAGATTCAGGTACAGGTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086437 Nonsense 647 656 5 5
Genomic Location (Zv9):
Chromosome 11 (position 18605212)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18030243
GRCz11 11 18243672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTAGTGTTGGCTTTTCTGTGGCGGAATTGKGAAGCCATGTCGCAGTA[T/A]GTTGACCGATTTTTGCWGCACCCTAGATGACCTGCAGGGGCGCTGCTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link