zgc:153254

Ensembl ID:
ENSDARG00000060929
ZFIN ID:
ZDB-GENE-060929-1006
Description:
hypothetical protein LOC561654 [Source:RefSeq peptide;Acc:NP_001070038]
Human Orthologue:
RNF220
Human Description:
ring finger protein 220 [Source:HGNC Symbol;Acc:25552]
Mouse Orthologue:
Rnf220
Mouse Description:
ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19803 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa19803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086340 Missense 42 307 3 11
ENSDART00000134651 Essential Splice Site 337 577 None 14
ENSDART00000136330 Essential Splice Site 76 197 None 8
ENSDART00000139295 Essential Splice Site 40 232 None 9
ENSDART00000143879 Missense 42 70 3 7
ENSDART00000145588 Missense 77 139 4 5
Genomic Location (Zv9):
Chromosome 2 (position 32911694)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33210601
GRCz11 2 33193819
KASP Assay ID:
2259-2246.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGCCCGGATTGGGAAAATGAAGCGCCGGAAGCCTGAGGATGGACAGG[T/C]ATGTCCACTGTGCAGCGCCCCGCTGGCAGGGACAGAGGAGGAAATGAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link