Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-197n10.2
- Ensembl ID:
- ENSDARG00000060917
- ZFIN ID:
- ZDB-GENE-030131-4486
- Description:
- anillin, actin binding protein-like [Source:RefSeq peptide;Acc:NP_001096146]
- Human Orthologue:
- ANLN
- Human Description:
- anillin, actin binding protein [Source:HGNC Symbol;Acc:14082]
- Mouse Orthologue:
- Anln
- Mouse Description:
- anillin, actin binding protein Gene [Source:MGI Symbol;Acc:MGI:1920174]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa45680 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45680
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000086295 | Essential Splice Site | 704 | 1171 | 11 | 25 |
| ENSDART00000086298 | Essential Splice Site | 654 | 1092 | 10 | 22 |
| ENSDART00000113574 | Essential Splice Site | 704 | 1153 | 11 | 24 |
| ENSDART00000136895 | Essential Splice Site | 651 | 1089 | 10 | 22 |
| ENSDART00000145883 | None | 158 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 19 (position 36991299)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 35855819 GRCz11 19 35442939 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGCATTGATGTTCTAGATGAGCAACAAAACCAGAAACTTCTCTATAGG[T/C]GCGTATCTGCTGCTTCTCCATGTTCAAGCGGTATTCAAACTTATTTGTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
