si:ch211-197n10.2

Ensembl ID:
ENSDARG00000060917
ZFIN ID:
ZDB-GENE-030131-4486
Description:
anillin, actin binding protein-like [Source:RefSeq peptide;Acc:NP_001096146]
Human Orthologue:
ANLN
Human Description:
anillin, actin binding protein [Source:HGNC Symbol;Acc:14082]
Mouse Orthologue:
Anln
Mouse Description:
anillin, actin binding protein Gene [Source:MGI Symbol;Acc:MGI:1920174]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45680 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086295 Essential Splice Site 704 1171 11 25
ENSDART00000086298 Essential Splice Site 654 1092 10 22
ENSDART00000113574 Essential Splice Site 704 1153 11 24
ENSDART00000136895 Essential Splice Site 651 1089 10 22
ENSDART00000145883   None 158 None 6
Genomic Location (Zv9):
Chromosome 19 (position 36991299)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35855819
GRCz11 19 35442939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCATTGATGTTCTAGATGAGCAACAAAACCAGAAACTTCTCTATAGG[T/C]GCGTATCTGCTGCTTCTCCATGTTCAAGCGGTATTCAAACTTATTTGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link