
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-126i22.5
- Ensembl ID:
- ENSDARG00000060911
- ZFIN ID:
- ZDB-GENE-091204-183
- Human Orthologue:
- KIAA1958
- Human Description:
- KIAA1958 [Source:HGNC Symbol;Acc:23427]
- Mouse Orthologue:
- E130308A19Rik
- Mouse Description:
- RIKEN cDNA E130308A19 gene Gene [Source:MGI Symbol;Acc:MGI:2442164]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31767 | Nonsense | Available for shipment | Available now |
sa41601 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31768 | Nonsense | Available for shipment | Available now |
sa8533 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa31767
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086269 | None | 652 | None | 12 | |
ENSDART00000135355 | Nonsense | 328 | 883 | 2 | 7 |
ENSDART00000143615 | Nonsense | 226 | 266 | 1 | 3 |
ENSDART00000145673 | None | 131 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 11253495)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 11329361 GRCz11 10 11287599 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGGAGAGGCTTCGATTGGCGCAAACCCAGAAATGGATCTTCTATCTGCA[C/T]AGGCACTTAGTACAGAAGCGAGAGCAGACAACACAGGTAAAGAGCCTTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41601
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086269 | Nonsense | 318 | 652 | 12 | 12 |
ENSDART00000135355 | Nonsense | 549 | 883 | 7 | 7 |
ENSDART00000143615 | None | 266 | None | 3 | |
ENSDART00000145673 | None | 131 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 11277231)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 11353097 GRCz11 10 11311335 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTCCCTTCTTCCCTTTCAGCAGACATGGATGAGAGAGCGTATCCAGAA[C/T]AGAACGAGAAGACGATTCGCAGCACCCAAACAGCTCTCCGCAACTTTCGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31768
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086269 | Nonsense | 344 | 652 | 12 | 12 |
ENSDART00000135355 | Nonsense | 575 | 883 | 7 | 7 |
ENSDART00000143615 | None | 266 | None | 3 | |
ENSDART00000145673 | None | 131 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 11277309)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 11353175 GRCz11 10 11311413 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAACAGCTCTCCGCAACTTTCGGGATTTCCTGGTTTCAAAGTATCCAAAC[G/T]AGACCAGAGAAATTTACAACATCCCCTGCCACGAGTTAGACATCTACTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8533
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086269 | Nonsense | 405 | 652 | 12 | 12 |
ENSDART00000135355 | Nonsense | 636 | 883 | 7 | 7 |
ENSDART00000143615 | None | 266 | None | 3 | |
ENSDART00000145673 | None | 131 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 11277492)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 11353358 GRCz11 10 11311596 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACGCTATCTGAAGGAGCATCGGTATGCCTACAGTWTTACAAGAGACCGC[G/T]AGTTCCAGAGATCCCAGGATGCCCTCAAGCAAAAGCAACTGGAGCTCAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: