zgc:158653

Ensembl ID:
ENSDARG00000060901
ZFIN ID:
ZDB-GENE-070112-502
Description:
tripartite motif-containing protein 62 [Source:RefSeq peptide;Acc:NP_001074143]
Human Orthologue:
TRIM62
Human Description:
tripartite motif-containing 62 [Source:HGNC Symbol;Acc:25574]
Mouse Orthologue:
Trim62
Mouse Description:
tripartite motif-containing 62 Gene [Source:MGI Symbol;Acc:MGI:1914775]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15656 Nonsense Available for shipment Available now
sa31846 Essential Splice Site Available for shipment Available now
sa16952 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086296 Nonsense 4 475 2 6
Genomic Location (Zv9):
Chromosome 11 (position 41892160)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40151941
GRCz11 11 40416086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YACCTGCACAGTGCATGACCGACTCCTCCATAGATTCAAATGGCTAGCTA[T/A]CTGAAGGACGAGCTCTTGTGTTCTATTTGTCWGAGCATTTATCAAGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086296 Essential Splice Site 293 475 5 6
Genomic Location (Zv9):
Chromosome 11 (position 41823801)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40083582
GRCz11 11 40347727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTTACAGTATACGATCTGGAAGTCTCTTTTCTTGGATATTTCACCAGG[T/G]AATGTGCCAGAACTTGAGTTATTTGTTTTTTAATGTTAGAGTATTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086296 Nonsense 325 475 6 6
Genomic Location (Zv9):
Chromosome 11 (position 41808492)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40068273
GRCz11 11 40332418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCTTATCAGACGACTGCACCATCGTGGCGTATGGCAACCTGCAYCCG[C/T]AGCCCTTGCAGGATTCACCRCGCCGATTCGACGTRGAGGTGTCCGTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link