si:dkey-24l11.1

Ensembl ID:
ENSDARG00000060879
ZFIN ID:
ZDB-GENE-050419-117
Description:
hypothetical protein LOC571287 [Source:RefSeq peptide;Acc:NP_001074966]
Human Orthologues:
SLC28A1, SLC28A2
Human Descriptions:
solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 [Source:HGNC Symbol;Acc:1
solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 [Source:HGNC Symbol;Acc:1
Mouse Orthologues:
Gm14085, Slc28a1, Slc28a2
Mouse Descriptions:
predicted gene 14085 Gene [Source:MGI Symbol;Acc:MGI:3702173]
solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 Gene [Source:MGI Symbol;A
solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 Gene [Source:MGI Symbol;A

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23315 Nonsense Available for shipment Available now
sa17349 Nonsense Available for shipment Available now
sa36664 Essential Splice Site Available for shipment Available now
sa23316 Nonsense Available for shipment Available now
sa36665 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086215 Nonsense 5 654 2 18
ENSDART00000098356 Nonsense 5 589 2 17
ENSDART00000132728   None 632 None 17
Genomic Location (Zv9):
Chromosome 18 (position 26773697)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26846952
GRCz11 18 26829330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTTAAGCTGGTAAAGCCCTTTTGGTTACTTTTCTTGCAGAGGACAAA[G/T]AAGATTTGCAGTTGACGGACGTCTCGTATGGGAACGAACAAGGCGTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086215 Nonsense 126 654 5 18
ENSDART00000098356 Nonsense 126 589 5 17
ENSDART00000132728 Nonsense 112 632 4 17
Genomic Location (Zv9):
Chromosome 18 (position 26775379)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26848634
GRCz11 18 26831012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACTTGTCTGGGRGTTTTCATCCTCGTGTGCGAACTAGTGTTTCGGTA[C/A]AAGGKTGACAGCATCAAGAGGTGCYTCAAGCCTGTGCAGMGATGTTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086215 Essential Splice Site 151 654 5 18
ENSDART00000098356 Essential Splice Site 151 589 5 17
ENSDART00000132728 Essential Splice Site 137 632 4 17
Genomic Location (Zv9):
Chromosome 18 (position 26775454)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26848709
GRCz11 18 26831087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAGCCTGTGCAGAGATGTTTTAGATCCAATATGAAATGGATGAAATG[G/T]TGAGTAGGACTTTAATACACTATACCCTTAAATCTTTAATGTTTTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086215 Nonsense 397 654 12 18
ENSDART00000098356 Nonsense 397 589 12 17
ENSDART00000132728 Nonsense 383 632 11 17
Genomic Location (Zv9):
Chromosome 18 (position 26788715)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26861970
GRCz11 18 26844348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTACCCTGAAACGGAAAAGAGCAAGTTCACATCTAAAAGTCAAATT[A/T]AAGTGGACAGTGGGTGGGTTTACCTCTCACATATGAGTTAAGGTGTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086215 Essential Splice Site 522 654 14 18
ENSDART00000098356   None 589 None 17
ENSDART00000132728 Essential Splice Site 508 632 13 17
Genomic Location (Zv9):
Chromosome 18 (position 26791359)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26864614
GRCz11 18 26846992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCTTAATGGCATTTTAGATGACAACGGAGATCCAAATTGGATCTCAG[T/A]AAGTATTTGTGTGGGCTCATCAAAATATGCATAAATTTGCCATTAACATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link