si:dkeyp-33d3.1

Ensembl ID:
ENSDARG00000060871
ZFIN ID:
ZDB-GENE-090313-382
Human Orthologue:
MCTP1
Human Description:
multiple C2 domains, transmembrane 1 [Source:HGNC Symbol;Acc:26183]
Mouse Orthologue:
Mctp1
Mouse Description:
multiple C2 domains, transmembrane 1 Gene [Source:MGI Symbol;Acc:MGI:1926021]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21815 Nonsense Available for shipment Available now
sa44733 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086220 Nonsense 324 858 6 20
ENSDART00000135680   None 93 None 3
Genomic Location (Zv9):
Chromosome 10 (position 45397754)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44048817
GRCz11 10 43895614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGATGCAGCAGCAGAGTCCCCGTCTGTCAGATCTGCACAGAAAGCCT[C/T]AGATGTGGAAGGGTATTGTGAGCATCAGACTCATCGAGGGACGAAATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086220 Essential Splice Site 571 858 11 20
ENSDART00000135680   None 93 None 3
Genomic Location (Zv9):
Chromosome 10 (position 45387566)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44038629
GRCz11 10 43885426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACCGCAGTGCTGACTTTCTGGGAAAAGTGGCCATCCCTTTATTAAAC[G/T]TGAGTGTGTCTCCATCATTACACTGCAGACAGCCAGTCGAGGAGATTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association and meta-analysis of bipolar disorder in individuals of European ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link