LOC568340

Ensembl ID:
ENSDARG00000060868
Human Orthologue:
MBTD1
Human Description:
mbt domain containing 1 [Source:HGNC Symbol;Acc:19866]
Mouse Orthologue:
Mbtd1
Mouse Description:
mbt domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2143977]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2643 Nonsense F2 line generated During 2018
sa22144 Essential Splice Site Available for shipment Available now
sa42070 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45467 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2643
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086087 Nonsense 150 705 4 17
Genomic Location (Zv9):
Chromosome 12 (position 35049446)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33453555
GRCz11 12 33554538
KASP Assay ID:
554-2918.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCGTTAATGGCAAAGTTGGCAGCTTATGCACAGTATCAAGCAAGTCAA[C/T]AGAACCAAGCTAAATCAAAATCAGGTAAAATGGCTTATTTTAGTGTTNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086087 Essential Splice Site 158 705 4 17
Genomic Location (Zv9):
Chromosome 12 (position 35049420)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33453529
GRCz11 12 33554512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGCACAGTATCAAGCAAGTCAACAGAACCAAGCTAAATCAAAATCAGG[T/C]AAAATGGCTTATTTTAGTGTTGTTATGTAATTATATGCCTGAATGATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086087 Essential Splice Site 396 705 10 17
Genomic Location (Zv9):
Chromosome 12 (position 35046906)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33451015
GRCz11 12 33551998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAGATTGAGGGTCAGATGGATGCTCCCTCACAGCTGTTTCTTAAGG[T/G]GCTTTTATAATTGCTTTTTTATTCAACAGTTTGTATACACTCCACTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086087 Nonsense 578 705 14 17
Genomic Location (Zv9):
Chromosome 12 (position 35041989)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33446098
GRCz11 12 33547081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGAGTCTCCAGATCTCTACCCCATAGGCTGGTGCCAACTGACCGGCTA[T/A]CAGCTGCAGCCGCCTGCCGCACAGAGTGAGTAAACAGCAATGAACATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link